You are here

  • Home
  • Archive
  • Volume 11, Issue 12
  • iPSC-derived natural killer cells expressing the FcγR fusion CD64/16A can be armed with antibodies for multitumor antigen targeting

Article Text

Article menu

This article has a correction. Please see:

Download PDFPDF

Immune cell therapies and immune cell engineering
Original research
iPSC-derived natural killer cells expressing the FcγR fusion CD64/16A can be armed with antibodies for multitumor antigen targeting
  1. Kristin M Snyder1,
  2. Kate J Dixon1,
  3. Zachary Davis2,
  4. Martin Hosking3,
  5. Geoffrey Hart2,
  6. Melissa Khaw2,
  7. Anders Matson1,
  8. Ryan Bjordahl3,
  9. Bryan Hancock3,
  10. Soheila Shirinbak3,
  11. Jeffrey S Miller2,
  12. Bahram Valamehr3,
  13. Jianming Wu1 and
  14. Bruce Walcheck1
  1. 1Department of Veterinary and Biomedical Sciences, University of Minnesota, Saint Paul, Minnesota, USA
  2. 2Department of Medicine, University of Minnesota, Minneapolis, Minnesota, USA
  3. 3Fate Therapeutics Inc, San Diego, California, USA
  1. Correspondence to Dr Bruce Walcheck; walch003{at}umn.edu

Abstract

Background Antibody therapies can direct natural killer (NK) cells to tumor cells, tumor-associated cells, and suppressive immune cells to mediate antibody-dependent cell-mediated cytotoxicity (ADCC). This antigen-specific effector function of human NK cells is mediated by the IgG Fc receptor CD16A (FcγRIIIA). Preclinical and clinical studies indicate that increasing the binding affinity and avidity of CD16A for antibodies improves the therapeutic potential of ADCC. CD64 (FcγRI), expressed by myeloid cells but not NK cells, is the only high affinity IgG Fc receptor and is uniquely capable of stably binding to free monomeric IgG as a physiological function. We have reported on the generation of the FcγR fusion CD64/16A, consisting of the extracellular region of CD64 and the transmembrane and cytoplasmic regions from CD16A, retaining its signaling and cellular activity. Here, we generated induced pluripotent stem cell (iPSC)-derived NK (iNK) cells expressing CD64/16A as a potential adoptive NK cell therapy for increased ADCC potency.

Methods iPSCs were engineered to express CD64/16A as well as an interleukin (IL)-15/IL-15Rα fusion (IL-15RF) protein and differentiated into iNK cells. iNK cells and peripheral blood NK cells were expanded using irradiated K562-mbIL21-41BBL feeder cells and examined. NK cells, ovarian tumor cell lines, and therapeutic monoclonal antibodies were used to assess ADCC in vitro, performed by a DELFIA EuTDA assay or in real-time by IncuCyte assays, and in vivo. For the latter, we developed a xenograft mouse model with high circulating levels of human IgG for more physiological relevance.

Results We demonstrate that (1) iNK-CD64/16A cells after expansion or thaw from cryopreservation can be coupled to therapeutic antibodies, creating armed iNK cells; (2) antibody-armed iNK-CD64/16A cells can be redirected by added antibodies to target new tumor antigens, highlighting additional potential of these cells; (3) cytokine-autonomous activity by iNK-CD64/16A cells engineered to express IL-15RF; and that (4) antibody-armed iNK-CD64/16A cells thawed from cryopreservation are capable of sustained and robust ADCC in vitro and in vivo, as determined by using a modified tumor xenograft model with high levels of competing human IgG.

Conclusions iNK cells expressing CD64/16A provide an off-the-shelf multiantigen targeting platform to address tumor heterogeneity and mitigate antigen escape.

  • Immunity, Innate
  • Immunotherapy
  • Killer Cells, Natural

Data availability statement

Data are available upon reasonable request. All data relevant to the study are included in the article or uploaded as supplementary information.

http://creativecommons.org/licenses/by-nc/4.0/

This is an open access article distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited, appropriate credit is given, any changes made indicated, and the use is non-commercial. See http://creativecommons.org/licenses/by-nc/4.0/.

https://doi.org/10.1136/jitc-2023-007280

Statistics from Altmetric.com

    Request Permissions

    If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.

    WHAT IS ALREADY KNOWN ON THIS TOPIC

    • Allogeneic natural killer (NK) cell adoptive transfer has shown clinical benefit in patients with cancer. These cells can recognize and kill tumor cells in an antigen-specific manner by antibody-dependent cell-mediated cytotoxicity (ADCC), which is exclusively mediated by the IgG Fc receptor CD16A. However, inherent attributes of this receptor limit the ADCC potency of adoptively transferred NK cells.

    WHAT THIS STUDY ADDS

    • Our study demonstrates that NK cells derived from engineered induced pluripotent stem cell (iPSCs) expressing the high affinity FcγR fusion CD64/16A can be armed with antibody therapies targeting different tumor antigens, cryopreserved, thawed, and mediate ADCC in vitro and in vivo.

    HOW THIS STUDY MIGHT AFFECT RESEARCH, PRACTICE OR POLICY

    • iPSC-derived NK cells expressing CD64/16A for enhanced ADCC provide a unique off-the-shelf platform for multiantigen targeting to address tumor heterogeneity and antigen escape.

    Background

    Natural killer (NK) cells are cytotoxic lymphocytes of the innate immune system . These cells express numerous germline-encoded activating and inhibitory receptors for assessing ligand levels on cells in the body to remove transformed or pathogen-infected cells.1 In addition, NK cells are directed to antigens on cellular targets through the recognition of antibodies to mediate antibody-dependent cell-mediated cytotoxicity (ADCC).2 Upon their activation, NK cells rapidly release cytolytic and apoptotic factors, as well as cytokines and chemokines that stimulate and recruit other leukocytes.3 Due to these assorted effector functions, there have been increasing clinical investigations into NK cells as an adoptive cell therapy (ACT) for cancer. Allogeneic NK cells have been a particular focus due to their off-the-shelf applications and differentiated safety profile compared with allogeneic T-cell therapies, including reduced graft versus host disease and cytokine release syndrome.1 4

    ADCC by human NK cells is exclusively mediated by CD16A (FcγRIIIA).1 2 Inherent attributes of this IgG Fc receptor affect its binding affinity and avidity. For the latter, cell surface levels of CD16A undergo a rapid downregulation by a disintegrin and metalloproteinase-17 (ADAM17, CD156b) upon NK cell activation by CD16A signaling and various other stimuli as a negative feedback process.5 CD16A downregulation can also occur in the microenvironment of solid tumors, as has been reported in patients with ovarian cancer.6–8 Indeed, ADAM17 induction occurs under conditions of hypoxia,9 further linking its activity to the tumor microenvironment. CD16A allelic variants significantly affect receptor affinity for IgG. CD16A with a phenylalanine at position 158 binds to IgG1 with at least twofold lower affinity than CD16A with a valine at the same position.10 Of note is that approximately 80% of the population expresses a low affinity allele of CD16A.11–13

    Clinical studies indicate that higher affinity and avidity interactions between CD16A and therapeutic monoclonal antibodies (mAbs) increases ADCC activity by NK cells.12 14–16 With the goal of augmenting ADCC potency by adoptive NK cell therapies, we generated the recombinant fusion FcγR CD64/16A for NK cell expression.17 Its extracellular region consists of human CD64 (FcγRI), the only high affinity IgG Fc receptor and mainly expressed by myeloid cell populations.18 CD64 binds to IgG1 with 30–100-fold higher affinity than CD16A depending on the CD16A allelic variant.10 CD64/16A contains transmembrane and cytoplasmic regions from CD16A. The latter associates with the signaling adaptors FcεRγ and CD3ζ and is a highly potent activating receptor in NK cells.19–21 CD64/16A also lacks the ADAM17 membrane proximal cleavage site of CD16A,17 which is intended to prevent its downregulation on NK cell thaw from cryopreservation, activation, proliferation, and by aberrant ADAM17 induction in the tumor microenvironment.22 The ability of CD64/16A to induce ADCC was initially investigated using NK-92 cells,17 a human NK cell line that lacks expression of endogenous FcγRs.23 Of interest is that due to its high affinity state, CD64/16 can stably bind to monomeric IgG1 and therefore provide a capturing element for antitumor therapeutic mAbs,17 22 which is referred to here as antibody arming.

    Our approach in this study focused on induced pluripotent stem cell (iPSC) derived NK cells (iNK cells).24 Like human peripheral blood (PB) NK cells, iNK cells mediate their effector functions against tumor cells through granule release of perforins and granzymes, TRAIL and FasL production, and cytokine release, including interferon (IFN)-γ and tumor necrosis factor (TNF)-α.25 iNK cells have been shown to be equally or more effective than PB NK cells against various tumor cell targets including ovarian cancer cells in vitro and in xenograft mouse models.26 27 Other advantages of iNK cells are their homogeneity and clinically scalable production.28 Importantly, iPSCs are amendable to genetic modifications, allowing for the generation of multiplexed edited NK cells to create increasingly more functional, hypoimmunogenic, and persistent effector cells.25 29 We investigated antibody-armed iNK-CD64/16A cells targeting tumor antigens on ovarian cancer cell lines by in vitro and in vivo approaches. We demonstrate that these cells can be armed with different therapeutic mAbs immediately after expansion or on thaw from cryopreservation; antibody-armed iNK-CD64/16A cells thawed from cryopreservation are capable of continuous ADCC; and that antibody-armed iNK-CD64/16A cells can be repurposed to target new tumor antigens by addition of different therapeutic mAbs. These findings underscore the potential of iNK-CD64/16A cells as an off-the-shelf ACT strategy for multitumor antigen targeting to overcome tumor heterogeneity and antigen escape.

    Methods

    Antibodies

    Antibodies used for the detection of CD64 (clone 10.1), CD3 (clone UCHT1), CD45 (clone 2D1), CD56 (clone HCD56), CD107a (clone H4A3), and CD16 (clone 3G8) were obtained from BioLegend (San Diego, California, USA). Therapeutic mAbs used were avelumab (Pfizer, New York, New York, USA), cetuximab (Lilly, Indianapolis, Indianapolis, USA), and trastuzumab (Genentech, San Francisco, California, USA). All immunophenotypic flow cytometry was performed using an FACSCelesta (BD Biosciences, San Jose, California, USA), and data was analyzed using FlowJo software (BD Biosciences). For controls, fluorescence minus one was used as well as appropriate isotype-matched antibodies since the cells of interest expressed FcRs.

    Cell lines

    The SKOV-3 (HTB-77) ovarian cancer cell line was purchased from American Type Culture Collection (Manassas, Virginia, USA) and were maintained in McCoy’s 5A media (Gibco, Waltham, Massachusetts, USA) supplemented with 10% fetal bovine serum (FBS) (Gibco) and 1× pen–strep (Gibco). SKOV-3 cells stably expressing firefly luciferase (SKOV-3-Luc), NucLightGreen (NLG), or NucLightRed (NLR) (Sartorius, Göttingen, Germany) were generated as previously described.30 The cancer cell lines OVCAR-4 (SCC258) and OVCAR-5 (SCC259) were purchased from MilliporeSigma (Burlington, Massachusetts, USA) and were maintained in Roswell Park Memorial Institute (RPMI)-1640 media (Gibco) supplemented with 10% FBS and 1× pen–strep. Cells were routinely tested for Mycoplasma with the MycoAlert Mycoplasma Test Kit (Lonza, Basel, Switzerland).

    iNK and PB NK cell culture

    iPSCs were generated by a transgene-free approach in feeder-free culture conditions that maintain pluripotency and genomic stability.24 iPSCs were engineered to express CD64/16A and an interleukin (IL)-15/IL-15Rα fusion (IL-15RF) protein by sequential lentiviral transduction, as previously described.17 31 For this preclinical study, transduced engineered pools instead of clonal lines were used and additional genomic stability analysis was not performed. The iPSCs were differentiated into iCD34 cells then iNK cells using established methodology.31 32 Differentiated iNK cells or PB NK cells were expanded for 2 weeks using irradiated K562-mbIL21-41BBL feeder cells.32 Briefly, this was done at a 1:2 NK cell:feeder cell ratio in B0 media:Dulbecco's Modified Eagle Medium (DMEM) and Ham’s F-12 (2:1 ratio) (Corning, Corning, New York, USA), 10% heat inactivated Human AB serum (Valley Biomedical, Winchester, Virginia, USA), 1% penicillin−streptomycin (Gibco), 20 µM β-mercaptoethanol (MilliporeSigma), 10 µg/mL ascorbic acid (MilliporeSigma), 1.5 ng/mL sodium selenite (MilliporeSigma), 50 µM ethanolamine (MilliporeSigma), and 10 mM HEPES (Gibco). Differentiated iNK cells were supplemented with 200 IU of rhIL-2/ml (R&D Systems, Minneapolis, Minnesota, USA), while PB NK cells were supplemented with 50 IU of rhIL-2/ml.

    PB NK cells were obtained from healthy consenting adults at the University of Minnesota. Briefly, PB mononuclear cells were isolated using Lymphocyte Separation Medium (Corning, Tewksbury, Massachusetts, USA) per the manufacturer’s instructions. NK cells were enriched using a negative selection human NK Cell Isolation Kit (Miltenyi Biotec, Bergisch, Germany). Isolated NK cells were >95% pure, as determined by CD56+ CD3− staining for flow cytometry. Cryopreservation was performed using CryoStor CS10 Cell Freezing Medium (STEMCELL Technologies, British Columbia, Canada) at 1×107 to 2.5×107 cells per mL in cryogenic vials. Vials were placed in freezer storage containers with isopropyl alcohol for controlled rate freezing at −80°C for 24 hours. Vials were then moved to liquid nitrogen for storage. Recovery of cryopreserved cells was performed by floating a vial in a 37°C water bath for 1 min until partially thawed. Pre-warmed X-VIVO 15 media (Lonza, Basel, Switzerland) was slowly added to the vial and the cell suspension transferred to a 50 mL conical tube containing 10 mL of X-VIVO 15 media. Cells were centrifuged at 300×g for 5 min and resuspended in X-VIVO 15 for experiments unless otherwise noted.

    NK cell antibody arming

    iNK cells and PB NK cells were armed with therapeutic mAbs at a cell density of 5×106 cells/mL with 5 µg/mL of trastuzumab or cetuximab in X-VIVO 15 media (Lonza) supplemented with 200 or 50 IU/mL rhIL-2, respectively, for 2 hours at 37°C and 5% CO2. The antibody-armed cells were extensively washed with X-VIVO 15 media to remove excess unbound antibody.

    Therapeutic antibodies were biotinylated using the EZ-Link Sulfo-NHS-Biotin Kit (Thermo Fisher) according to the manufacturer’s instructions. iNK cells or PB NK cells were armed with biotinylated antibodies as described above. To determine levels of antibody coupling, cells were incubated with a streptavidin conjugated fluorophore (BioLegend) for 15 min at room temperature. Cells were extensively washed and streptavidin staining was assessed by flow cytometry.

    Cell cytotoxicity assays

    Cell cytotoxicity was measured using the DELFIA EuTDA assay (PerkinElmer, Waltham, Massachusetts, USA) per the manufacturer’s instructions and as previously described.17 To measure cell cytotoxicity in real-time, NLR or NLG SKOV-3 cells were used as well as OVCAR-4 and OVCAR-5 labeled with CellTrace Far Red (Thermo Fisher) according to the manufacturer’s instructions. The tumor cells were plated at a density of 4×103 (SKOV-3) or 6×103 (OVCAR-4 and OVCAR-5) cells/well in a 96-well flat bottom, tissue culture-treated plate 24 hours prior to starting the assay. iNK cells or PB NK cells were added at the indicated effector:target (E:T) ratios in X-VIVO 15 media supplemented with 200 IU or 50 IU of rhIL-2, respectively, at 37°C and 5% CO2. Fluorescent images of live cells were obtained hourly for the duration of the assay using an IncuCyte SX3 live cell imaging and analysis system (Sartorius), as we have previously described.30 31 33 34 Data are presented as a single normalized frequency of target cells remaining. Area under the curve (AUC) was computed using GraphPad Prism (La Jolla, California, USA).

    Analysis of CD107a expression and cytokine production

    iNK-CD64/16A cells were co-cultured with SKOV3 cells at an E:T ratio of 1:1 for 5 hours at 37°C and 5% CO2. Fluorophore-conjugated anti-CD107a was added prior to NK cell stimulation, and GolgiStop (BD Biosciences) was added for the final 4 hours of co-culture. Cell surface CD107a expression was determined by flow cytometry. Additionally, iNK-CD64/16A cells were co-cultured with SKOV-3 cells at an E:T ratio of 2:1 for 4 and 18 hours at 37°C and 5% CO2. After incubation, the plate was centrifuged for 5 min at 2200×g and supernatant was removed and frozen at −80°C. The production of IFN-γ and TNF-α were quantified using LEGENDplex human IFN-γ and TNF-α capture beads (BioLegend) following manufacturer’s instructions for cell culture supernatant. Beads were acquired on an FACSCelesta and data analyzed using LEGENDplex software.

    CRISPR/Cas9 knockout of HER2 and EGFR in SKOV-3 cells

    Single guide RNAs (sgRNA) for human Human epidermal growth factor receptor 2 (HER2) or epidermal growth factor receptor (EGFR) were designed using Synthego’s Knockout Guide Design tool (https://design.synthego.com/#/); HER2 sgRNA sequence: UCUCUCCUGCCAGUGUGCAC, and EGFR sgRNA: CUUUUUCUUCCAGUUUGCCA. Alt-R CRISPR-Cas9 sgRNAs were ordered from Integrated DNA Technologies (IDT, Coralville, Iowa, USA). IDT sgRNAs contained both tracerRNA and crRNA sequences. Recombinant Cas9 protein was purchased from IDT. CRISPR/Cas9 ribonucleoprotein complexes (RNPs) were assembled by mixing 100 pmol of sgRNA with 30 pmol of Cas9. After assembly, RNP complexes rested at room temperature for 15 min. RNPs were combined with the Amaxa nucleofector solution from the SF Cell Line 4D-Nucleofector X Kit (Lonza). SKOV-3 NLR cells (2×105) were then resuspended in the RNP/nucleofector solution and transferred to a 20 µL Nucleocuvette strip and nucleofected with the Amaxa 4D Nucleofector program FE-132. Nucleofected SKOV-3 cells were gently resuspended with warm culture medium and transferred into a 24-well plate for initial expansion. SKOV-3 cells lacking HER2 and EGFR were enriched through negative sorting by staining the cells with biotinylated trastuzumab and cetuximab and using anti-biotin MicroBeads (Miltenyi Biotec) following the manufacturer’s instructions. SKOV-3 cells lacking HER2 and EGFR were confirmed by flow cytometry.

    Xenograft mouse model

    A short-term tumor xenograft model was used as previously described with some modifications.30 Briefly, 8–12 weeks old NOD-scid IL2Rgammanull (NSG) mice were intraperitoneal (i.p.) injected with 3×105 SKOV-3-Luc cells. Mice were administered iNK-CD64/16A or iNK-CD64/16A IL-15RF cells (1×107 cells) i.p. in 1× Hank's Balanced Salt Solution (HBSS). Where indicated, mice were given 50,000 IU of rhIL-2 i.p. three times a week for the duration of the experiment. rhIL-2 used for all in vivo assays was obtained from the Biological Resources Branch, National Cancer Institute (NCI), NIH. Bioluminescence imaging (BLI) was performed to quantify tumor burden using an in vivo imaging system (IVIS) Spectrum (PerkinElmer, Waltham, Massachusetts, USA). Images were analyzed using Living Image Software (PerkinElmer).

    For the human IgG xenograft model, NSG mice received i.p. administration of GAMMAGARD (Takeda, Lexington, Massachusetts, USA), pooled human IgG, at the indicated doses. To assess serum levels of human IgG isotypes, blood was collected via check bleed, allowed to clot at room temperature for 30 min, and centrifuged at 2230×g for 10 min. Serum was collected and saved for analysis by LEGENDplex Human Immunoglobulin Isotyping kit (BioLegend) per the manufacturer’s instructions. Mice were i.p. injected with SKOV-3-Luc cells and iNK-CD64/16A IL-15RF cells as indicated above. rhIL-2 was not administered. Some mice received cetuximab injections of 100 µg/mouse i.p. as indicated. Mice were monitored by BLI and survival assessed based on mobility and morbidity behavior.

    Statistical analysis

    Data are presented as the mean±SD. In vitro data are from at least three independent experiments. Each short-term tumor xenograft experiment is representative of at least two independent experiments. The human IgG xenograft experiments were performed twice. All statistical analyses were performed using GraphPad Prism (La Jolla, California, USA). Comparison between two groups was computed using the Student’s t-test, while comparison among three or more groups was carried out using one-way analysis of variance followed by Tukey honest significance difference (HSD) post hoc test. Statistical significance for percent change in radiance for in vivo studies was determined using the Mann-Whitney test. The survival curve was analyzed using the log-rank (Mantel-Cox) test. Significance was set as p≤0.05 for all statistical tests performed.

    Results

    Production and antibody arming of iNK-CD64/16A cells

    In this study, we used transgene-free iPSCs for iNK cell generation.31–33 We have previously shown that the derived iNK cells are phenotypically and transcriptionally similar to PB-derived NK cells.32 iPSCs were initially engineered to express CD64/16A, differentiated into iCD34+ hematopoietic progenitor cells, and then into early iNK cells. For the final step, iNK cells were co-cultured with K562-mbIL21-41BBL feeder cells for further maturation and expansion (figure 1A).32 The generated iNK cells (CD56+ CD3−) stained uniformly for CD64, whereas unmodified iNK control cells demonstrated no CD64 staining (figure 1A), as is also the case for PB NK cells (see figure 2A).17

    Figure 1
    Figure 1

    Antibody-armed iNK-CD64/16A cells mediate ADCC in vitro and in vivo. (A) Schematic and phenotyping of iPSC differentiation to expanded iNK-CD64/16A cells. Early iNK-CD64/16A cells were stained on days 20 and 30 with an anti-CD64 mAb. After 2 weeks of expansion and differentiation with K562-mbIL21-41BBL feeder cells, iNK cells were stained with anti-CD45, CD56, CD3, and CD64 mAbs. Cell staining was analyzed by flow cytometry; histograms are a representative of several independent expansions. (B) The ovarian cancer cell lines SKOV-3, OVCAR4, and OVCAR5 were stained with trastuzumab (anti-HER2), cetuximab (anti-EGFR), or a second stage fluorophore and analyzed by flow cytometry. The x-axis=log 10 fluorescence. (C) iNK-CD64/16A cells fresh off of expansion, either unarmed (iNK-CD64/16A) or armed with trastuzumab (iNK-CD64/16A Tras) or cetuximab (iNK-CD64/16A Cetux), were co-cultured with SKOV-3, OVCAR4, or OVCAR5 cells at the indicated E:T ratios. Target cell cytotoxicity was determined at 2 hours by a DELFIA EuTDA assay. Data represented as mean±SD; n=4 replicates; ****, p≤0.0001 by Student’s t-test. (D) NSG mice were implanted i.p. with SKOV-3-Luc cells (3×105), administered iNK-CD64/16A cells (1×107) i.p., and tumor burden evaluated by BLI, as indicated in the schematic. Tumor implanted mice were randomized into three groups: tumor alone (n=3), unarmed iNK-CD64/16A cells (iNK-CD64/16A) (n=5), or trastuzumab-armed iNK-CD64/16A cells (iNK-CD64/16A Tras) (n=5). iNK-CD64/16A cells were antibody armed fresh off of expansion. All mice received i.p. injections o IL-2 every other day. The y-axis=percent change in radiance, calculated for each animal at each time point using the formula (radiance day x/radiance day 0)×100. Radiance values for each animal at day 0 are represented as 100%. Data represented as mean±SD; *, p≤0.05; **, p≤0.01 by Mann-Whitney test. ADCC, antibody-dependent cell-mediated cytotoxicity; BLI, bioluminescence imaging; EGFR, epidermal growth factor receptor; E:T, effector:target; HER2, human epidermal growth factor receptor 2; IL-2, interleukin-2; iNK, induced pluripotent stem cell-derived NK cell; i.p., intraperitoneal; iPSC, induced pluripotent stem cell; mAb, monoclonal antibody; NK, natural killer.

    Figure 2
    Figure 2

    iNK-CD64/16A cells armed with antibodies after cryopreservation mediate ADCC. (A) Expanded then cryopreserved iNK-CD64/16A cells, iNK control cells, or PB NK cells were thawed and armed with biotinylated trastuzumab or cetuximab, washed, and stained with a streptavidin fluorophore. Unarmed cells were also stained with streptavidin fluorophore (no antibody). Cell staining levels were analyzed by flow cytometry. The x-axis=log 10 fluorescence. Flow cytometric analysis of CD16A and CD64 staining of PB NK cells was also performed (gray histograms). (B) iNK-CD64/16A, iNK control cells, or PB NK cells were thawed from cryopreservation, armed with trastuzumab or left unarmed, washed, and co-cultured with SKOV-3-NucLightGreen cells at the indicated E:T ratios. Cytotoxicity was assessed by live cell imaging. Percent of live target cells remaining are displayed relative to targets alone at time 0. The area under curve (AUC) of the remaining SKOV-3 was calculated for unarmed and antibody-armed NK cells. Data represented as mean±SD; n=4 replicates; ns, p>0.05; ****, p≤ 0.0001, by one-way ANOVA followed by Tukey HSD post hoc test. (C) Unarmed and trastuzumab-armed iNK-CD64/16A cells were incubated for 5 hours at 37°C in absence or presence of SKOV-3 cells at an E:T of 1:1, stained for CD107a, and examined by flow cytometry. Data represented as MFI±SD; n=3 replicates; ****, p≤ 0.0001, by one-way ANOVA followed by Tukey HSD post hoc test. ADCC, antibody-dependent cell-mediated cytotoxicity; ANOVA, analysis of variance; E:T, effector:target; HSD, honest significant difference; iNK, induced pluripotent stem cell-derived NK cell; MFI, mean fluorescence intensity; NK, natural killer; PB, peripheral blood.

    Due to the high affinity state of CD64, it stably binds to free monomeric IgG1.35 We have shown that NK-92 cells expressing CD64/16A can be armed with antitumor therapeutic mAbs, which did not occur for NK-92 cells expressing equivalent levels of the higher affinity variant of CD16A.17 iNK-CD64/16A cells can also be stably armed with antitumor therapeutic mAbs, as shown below. To test the ability of antibody-armed iNK-CD64/16A cells to mediate ADCC, we used the ovarian cancer cell lines SKOV-3, OVCAR4, and OVCAR5 as target cells. Each cell line expressed HER2 and EGFR at different levels (figure 1B). Freshly expanded iNK-CD64/16A cells when armed with trastuzumab or cetuximab, which recognize HER2 and EGFR, respectively, lysed target cells at significantly (p≤0.0001) higher levels than unarmed iNK-CD64/16A cells. This was determined by a DELFIA EuTDA-based short-term cytotoxicity assay (figure 1C), as a quick screen for ADCC effector function.

    To initially assess the antitumor function of the antibody-armed iNK-CD64/16A cells in vivo, we used a short-term intraperitoneal tumor xenograft model of ovarian cancer, as described earlier.30 SKOV-3 cells (3×105) expressing firefly luciferase were injected i.p. into NSG mice, the most common site for distant metastasis during ovarian cancer.36 Expanded iNK-CD64/16A cells (1×107) were either armed with trastuzumab or left unarmed, extensively washed, and then infused i.p. into the mice. Intraperitoneal administration of NK cells has been reported to be more effective than intravenous delivery in the xenograft mouse model,37 and is being evaluated in clinical trials to treat ovarian cancer.38 rhIL-2 was administered to all mice to support the proliferation and persistence of the iNK cells. Tumor burden was measured by BLI at 4 days post SKOV-3 cell implantation (Day 0) and at days 3 and 17 post-iNK cell infusion (as illustrated in figure 1D). By day 3, a significant reduction in tumor burden occurred in mice that received trastuzumab-armed iNK-CD64/16A cells when compared with mice that received tumor only or unarmed iNK-CD64/16A cells (p≤0.05 and p≤0.01, respectively; figure 1D). By day 17, unarmed CD64/16A cells effectively controlled tumor burden, consistent with their natural cytotoxicity effector function via germline receptors,32 and trastuzumab-armed iNK-CD64/16A cells demonstrated significantly greater tumor reduction (figure 1D). Taken together, the above findings show that freshly expanded, antibody-armed iNK-CD64/16A cells mediated ADCC in vitro and in vivo.

    We next examined if the high affinity state of CD64/16A allowed for mAb arming immediately following their thaw from cryopreservation. For these studies, we examined iNK-CD64/16A cells, iNK control cells, and PB NK cells. All cells were expanded by K562-mbIL21-41BBL feeder cells and cryopreserved in a similar manner. All NK cells on thaw were incubated with biotinylated trastuzumab or cetuximab, extensively washed, stained with fluorophore-labeled streptavidin, and examined by flow cytometry. Though thawed PB NK cells retained high levels of CD16A, only the iNK-CD64/16A cells were capable of stable antibody coupling (figure 2A). Thawed iNK-CD64/16A cells, iNK control cells, and PB NK cells were also incubated with or without non-labeled trastuzumab, washed, and co-cultured with SKOV-3 cells at different E:T ratios. Target cell killing was assessed by an IncuCyte-based live cell imaging assay for 48 hours. rhIL-2 was added to the assay to support NK cell survival. Natural cytotoxicity of tumor cells occurred by the different unarmed NK cells, but only the iNK-CD64/16A cells demonstrated significantly (p≤0.0001) increased tumor cell lysis when armed with trastuzumab (figure 2B).

    It has been reported that monomeric IgG attached to endogenous CD64 on leukocytes does not induce cell activation until it engages antigen.39 We evaluated this for antibody-armed iNK-CD64/16A cells by monitoring surface levels of CD107a, a marker of NK cell activation by CD16A signaling.40 As shown in figure 2C, unarmed and trastuzumab-armed iNK-CD64/16A cells treated for 5 hours at 37°C expressed equivalently low levels of CD107a. When co-cultured with SKOV-3 cells, only the trastuzumab-armed iNK-CD64/16A cells demonstrated a distinct upregulation of CD107a expression (figure 2C). This short-term assay detected robust iNK-CD64/16A cell activation and therefore we cannot rule out that antibody-arming of CD64/16A might cause a low level of tonic signaling in NK cells.

    Cryopreservation and function of antibody-armed iNK-CD64/16A cells for off-the-shelf therapeutics

    We next examined whether freshly expanded and antibody-armed iNK-CD64/16A cells could be cryopreserved and maintain their ADCC effector function on thaw. This was of interest since the use of cryopreserved antibody-armed iNK-CD64/16A cells would reduce the processing time between thawing and use in functional assays, as well as their administration into patients as an off-the-shelf cell therapy. To this end, expanded iNK-CD64/16A cells were armed with biotinylated-trastuzumab or cetuximab, excess antibody was washed away, and the cells were cryopreserved. We found that on thaw, the iNK-CD64/16A cells maintained high levels of antibody arming (figure 3A). In addition, their viability was similar to thawed, unarmed iNK-CD64/16A cells (data not shown). Thawed iNK-CD64/16A cells, either unarmed or armed with trastuzumab or cetuximab, were co-cultured with OVCAR-4 and OVCAR-5 cells labeled with CellTrace Far Red. Tumor cell lysis was determined by IncuCyte monitoring. A marked enhancement in tumor cell killing was observed by the thawed antibody-armed iNK-CD64/16A cells at different E:T ratios (figure 3B).

    Figure 3
    Figure 3

    Cryopreserved antibody-armed iNK-CD64/16A cells mediate ADCC. (A) iNK-CD64/16A cells were armed with biotinylated trastuzumab or cetuximab, washed, cryopreserved, thawed, and stained with a streptavidin fluorophore. Unarmed cells were also stained with streptavidin fluorophore (no antibody). Cell staining levels were analyzed by flow cytometry. The x-axis=log 10 fluorescence. (B) Thawed trastuzumab-armed iNK-CD64/16A cells (iNK-CD64/16A Tras) or unarmed iNK-CD64/16A cells (iNK-CD64/16A) were co-cultured with OVCAR-4 or OVCAR-5 labeled with CellTrace Far Red at the indicated E:T ratios. Cytotoxicity was assessed by live cell imaging. Percent of live target cells remaining are displayed relative to targets alone at time 0. (C) Thawed trastuzumab-armed iNK-CD64/16A cells (iNK-CD64/16A Tras) or unarmed iNK-CD64/16A cells (iNK-CD64/16A) were co-cultured with SKOV-3 cells at an E:T ratio of 2:1. TNF-α and IFN-γ levels in the media supernatant were quantified at the indicated time points. Data represented as mean±SD; n=3 replicates; ****, p≤0.0001, by one-way ANOVA followed by Tukey HSD post hoc test. (D) Thawed trastuzumab-armed iNK-CD64/16A cells (iNK-CD64/16A Tras) or unarmed iNK-CD64/16A cells (iNK-CD64/16A) were co-cultured with SKOV-3-NLG cells at the indicated E:T ratios. Remaining effector cells were then harvested and co-cultured with additional SKOV-3-NLR cells for a second round. This was repeated for a third round using SKOV-3-NLG cells. SKOV-3 cells expressing NLG or NLR were alternated between rounds to exclude target cells carried over from the previous round. Cytotoxicity was assessed by live cell imaging. Percent of live target cells remaining are displayed relative to targets alone at time 0. AUC of the remaining SKOV-3 was calculated for unarmed and antibody-armed NK cells. Data represented as mean±SD; n=8 replicates; ****, p≤0.0001, by one-way ANOVA followed by Tukey HSD post hoc test. (E) CRISPR/Cas9 genome editing was used to generate HER2 and EGFR knockout SKOV-3 cells. HER2 and EGFR expression by wild type SKOV-3 cells and SKOV-3 HER2− EGFR− cells was determined by flow cytometry. In addition, SKOV-3 cells were stained with avelumab (anti-PD-L1) and/or a fluorophore-conjugated secondary antibody and analyzed by flow cytometry. The x-axis=log 10 fluorescence. (F) Thawed trastuzumab or cetuximab-armed iNK-CD64/16A cells (iNK-CD64/16A Tras or Cetux) or unarmed iNK-CD64/16A cells (iNK-CD64/16A) were co-cultured with SKOV-3-NLG cells or SKOV-3 HER2− EGFR−-NLR cells (E:T=8:1). In some wells, avelumab was added to the cell culture (+ Avelu). Cytotoxicity was assessed by live cell imaging. Percent of live target cells remaining are displayed relative to targets alone at time 0. AUC of the remaining SKOV-3 was calculated for unarmed and antibody-armed iNK cells. Data represented as mean±SD; n=4 replicates; ***, p≤0.001; ****, p≤0.0001, by one-way ANOVA followed by Tukey HSD post hoc test. ADCC, antibody-dependent cell-mediated cytotoxicity; ANOVA, analysis of variance; AUC, Area under the curve; EGFR, epidermal growth factor receptor; E:T, effector:target, HER2, human epidermal growth factor receptor 2; HSD, honest significant difference; IFN, interferon; iNK, iNK, induced pluripotent stem cell-derived NK cell; KO, knock-out; NK, natural killer; NLG, NucLightGreen; NLR, NucLightRed; PD-L1, programmed cell death ligand 1; TNF, tumor necrosis factor; WT, wild-type.

    In additional assays, thawed iNK-CD64/16A cells armed with trastuzumab released significantly (p≤0.0001) higher levels of TNF-α and IFN-γ compared with unarmed iNK-CD64/16A when co-cultured with SKOV-3 cells (figure 3C). The latter iNK-CD64/16A cells did produce low levels of cytokines that was more apparent by 18 hours of activation, likely due to stimulation through their germline receptors (figure 3C). Thawed trastuzumab-armed iNK-CD64/16A cells also mediated higher levels of SKOV-3 cell killing (figure 3D). For this assay, we investigated ADCC durability by the thawed antibody-armed iNK CD64/16A cells. Unarmed or trastuzumab-armed iNK CD64/16A cells were collected at the conclusion of the assay and transferred to new wells containing fresh SKOV-3 cells for a second and then a third round of killing. To distinguish target cells in the new wells from any remaining live target cells carried over from previous wells, we alternated between SKOV-3 target cells expressing either NLG or NLR. For all rounds, the trastuzumab-armed iNK-CD64/16A cells maintained significantly (p≤0.0001) higher levels of killing than the unarmed iNK-CD64/16A cells at different E:T ratios (figure 3D). Hence, following a freeze/thaw cycle, antibody-armed iNK-CD64/16A cells retained their antigen specific effector function and could mediate sustained ADCC.

    An important feature of iNK-CD64/16A cells is the usage of multiple therapeutic mAbs for directing these cells to different targets on tumor cells to address antigen escape. In addition to HER2 and EGFR, programmed cell death ligand 1 (PD-L1) is also uniformly expressed by SKOV-3 cells, and it can be targeted by the therapeutic mAb avelumab (figure 3E, left panel). Thawed unarmed iNK-CD64/16A cells mediated significantly (p≤0.0001) enhanced SKOV-3 cell killing when in the presence of added avelumab (figure 3F). Culturing SKOV3 cells with avelumab alone had no effect on cell viability (data not shown). To simulate the loss of tumor antigens, we used CRISPR/Cas9 genome editing to generate SKOV-3 HER2− EGFR− cells (figure 3E, right panel). In contrast to wildtype cells, SKOV-3 HER2− EGFR− cells did not undergo ADCC by thawed trastuzumab or cetuximab-armed iNK-CD64/16A cells (figure 3F). However, the addition of avelumab to a co-culture of unarmed iNK-CD64/16 A cells or antibody-armed iNK-CD64/16A cells with SKOV-3 HER2− EGFR− cells significantly (p≤0.0001) increased ADCC (figure 3F). These assays show that iNK-CD64/16A cells could be directed to tumor antigens either by the addition of therapeutic mAbs or when the antibodies were used to arm the iNK cells. Moreover, antibody-armed iNK-CD64/16A cells could be redirected by the addition of a new therapeutic mAb to target a different tumor antigen.

    Generation of cytokine-autonomous iNK-CD64/16A cells to enhance therapeutic potential

    Human NK cell adoptive transfer into NSG mice and patients requires repeated bolus infusions of cytokines, such as IL-2 or IL-15, for their expansion and persistence.41 To eliminate the variability, toxicity, and potential detrimental immunoregulatory responses of this approach, we have engineered iNK cells to express a membrane-bound IL-15/IL-15RF protein.33 IL-15RF complexes with IL-2/IL-15Rβ and the common γ chain to provide self-stimulating signals that induce iNK cell activation and proliferation in vitro and in vivo.31 33 34 The same modification of iPSCs expressing CD64/16A was performed here. Their cytokine independence was verified using a previously described IncuCyte assay.31 iNK-CD64/16A cells expressing or lacking IL-15RF demonstrated equivalent levels of antibody arming (figure 4A). Trastuzumab-armed iNK-CD64/16A lacking IL-15RF were thawed from cryopreservation and incubated with SKOV-3 cells at different E:T ratios. Inclusion of IL-2 in the culture markedly enhanced ADCC (figure 4B). Antibody-armed iNK-CD64/16A cells expressing IL-15RF on the other hand demonstrated equivalent robust ADCC of SKOV3 cells in either the presence or absence of IL-2 (figure 4B), demonstrating the intrinsic function of IL-15RF in these cells.

    Figure 4
    Figure 4

    Cryopreserved antibody-armed iNK-CD64/16A cells expressing IL-15RF are cytokine-independent. (A) iNK-CD64/16A and iNK-CD64/16A IL-15RF cells were armed with biotinylated trastuzumab and cryopreserved. On thaw, the cells were stained with a streptavidin fluorophore, and analyzed for antibody arming by flow cytometry. The x-axis=log 10 fluorescence. (B) Unarmed or trastuzumab-armed iNK-CD64/16A or iNK-CD64/16A IL-15RF cells thawed from cryopreservation were co-cultured with SKOV-3-NucLightGreen cells at the indicated E:T ratios in the presence or absence of iIL-2. Cytotoxicity was assessed by live cell imaging. Percent of live target cells remaining are displayed relative to targets alone at time 0. (C) NSG mice were implanted i.p. with SKOV-3-Luc cells (3×105), administered iNK-CD64/16A IL-15RF cells (1×107) i.p., and tumor burden evaluated by BLI, as indicated in the schematic. Tumor implanted mice were randomized into three groups: tumor alone (n=6), unarmed iNK-CD64/16A IL-15RF cells (iNK-CD64/16A) (n=6), or trastuzumab-armed iNK-CD64/16A IL-15RF cells (iNK-CD64/16A Tras) (n=6). The y-axis=percent change in radiance, as described in figure 1D. Data represented as mean±SD; *, p≤0.05, **, p≤0.01 by Mann-Whitney test. BLI, bioluminescence imaging; E:T, effector:target; IL-2, interleukin-2; IL-15RF, interleukin-15Rα fusion; iNK, induced pluripotent stem cell-derived NK cell; i.p., intraperitoneal, NK, natural killer.

    The cytolytic activity of antibody-armed iNK-CD64/16A IL-15RF cells was also examined using our tumor xenograft model. Following i.p. implantation of SKOV-3 cells, unarmed or trastuzumab-armed iNK-CD64/16A IL-15RF cells were thawed from cryopreservation and i.p. administered to the mice in the absence of cytokine support. Tumor BLI was measured 4 days post SKOV-3 cell implantation (Day 0) and at days 3 and 14 post-iNK cell infusion. Significant (p≤0.05) reductions in tumor burden were observed at both time points in mice that received trastuzumab-armed iNK-CD64/16A IL-15RF cells compared with mice receiving unarmed iNK-CD64/16A cells (figure 4C).

    Evaluation of ADCC by antibody-armed iNK-CD64/16A IL-15RF cells in the presence of competing IgG in vivo

    IgG concentration in human blood typically ranges from 6 to 13 mg/mL.42 The intraperitoneal ascitic fluid concentration of IgG in patients with ovarian cancer is also high.43 Antibody-armed iNK-CD64/16A cells infused i.p. would thus be exposed to high levels of competing IgG in humans. Immunocompromised mouse strains used for xenograft models lack endogenous IgG, and mice with a humanized immune system have substantially lower basal levels of circulating IgG than healthy humans.44 For instance, humanized mice expressing human IL-6, which is important for B-cell differentiation, had baseline serum levels of IgG at ≈ 0.32 mg/mL.45 An approach to achieve high levels of human IgG in immunocompromised mice is by bolus IgG administration. The clearance rate of human IgG1 in NSG mice has been reported to decrease as the administration dose increases, revealing a non-linear drug disposition.46 We performed bolus i.p. administrations of GAMMAGARD, a pharmaceutical preparation of pooled human IgG derived from plasma, at 5, 20, or 50 mg per mouse. GAMMAGARD at 20 and 50 mg demonstrated similar systemic levels and clearance rates (data not shown), and thus we administered mice with 20 mg of GAMMAGARD for our experimental approach. Circulating levels of IgG1 averaged 11.1±4.3, 2.6±0.4, and 1.6±0.6 mg/mL at days 2, 7, and 14, respectively, post-administration (figure 5A).

    Figure 5
    Figure 5

    Cryopreserved antibody-armed iNK-CD64/16A IL-15RF cells mediate ADCC in vivo in the presence of competing IgG. (A) NSG mice were injected i.p. with 20 mg/mouse of GAMMAGARD and bled via cheek bleed on days 2, 4, 7, and 14. Serum IgG levels were measured using a human IgG isotyping kit. (B) NSG mice were implanted i.p. with SKOV-3-Luc cells (3×105), administered GAMMAGARD (20 mg) and iNK-CD64/16A IL-15RF cells (1×107) i.p., and tumor burden evaluated by BLI, as indicated in the schematic. (C) Tumor implanted mice were randomized into three groups: tumor alone (n=6), unarmed iNK-CD64/16A IL-15RF cells (iNK-CD64/16A) (n=6), or trastuzumab-armed iNK-CD64/16A IL-15RF cells (iNK-CD64/16A Tras) (n=6). All mice received i.p. injections of GAMMAGARD. The y-axis=percent change in radiance, as described in figure 1D. Data are represented as mean±SD; *, p≤0.05; **, p≤0.01 by Mann-Whitney test. For the purple line, statistical significance is indicated as ****p≤0.0001 versus days 3, 7, 14, and 21 by one-way analysis of variance, followed by Tukey HSD post hoc test. (D) Bioluminescence images through the first 3 weeks of the experiments. ADCC, antibody-dependent cell-mediated cytotoxicity; BLI, bioluminescence imaging; HSD, honest significant difference; IL-15RF, interleukin-15Rα fusion; iNK, induced pluripotent stem cell-derived NK cell; i.p., intraperitoneal; IVIS, in vivo imaging system; NK, natural killer.

    To assess ADCC in vivo by human NK cells in the presence of competing human IgG, the following modified version of the mouse xenograft model was performed. All mice were i.p. implanted with SKOV-3 cells and administered 20 mg GAMMAGARD (days −2 and 7). Mice then received thawed trastuzumab-armed or unarmed iNK-CD64/16A IL-15RF cells (figure 5B). An important advantage of iPSC-derived allogeneic NK cells, especially for treating solid tumors, is the ability to perform repeated dosing. This approach was also incorporated into our xenograft model. Unarmed and trastuzumab-armed iNK-CD64/16A IL-15RF cells were both observed to reduce tumor burden. The latter, however, did so in a much more striking manner and achieved significance compared with mice that received unarmed iNK-CD64/16A IL-15RF cells at days 3 (p≤0.05), 14 (p≤0.01), and 21 (p≤0.01) post-treatment (figure 5C,D). Moreover, only trastuzumab-armed iNK-CD64/16A IL-15RF cells maintained the tumor burden significantly (p≤0.0001) below day 0 levels at all subsequent time points (figure 5C, purple line).

    We also used the human IgG mouse xenograft model to examine the antitumor effects of administering antibody-armed iNK-CD64/16A IL-15RF cells in combination with a different infused therapeutic mAb. The potential therapeutic benefits of this approach are broader tumor antigen targeting and extended antibody recognition by the more persistent IL-15RF-expressing iNK-CD64/16A cells. Mice were treated as described above, but received two i.p administrations of thawed trastuzumab-armed iNK-CD64/16A IL-15RF cells followed by two i.p. administrations of cetuximab (figure 6A). Other groups of mice received unarmed iNK-CD64/16A IL-15RF cells or cetuximab alone. Mice that received trastuzumab-armed iNK-CD64/16A IL-15RF cells and cetuximab demonstrated significantly reduced tumor burden at days 7 (p≤0.01), 14 (p≤0.01), 21 (p≤0.01), and 28 (p≤0.05) compared with all other groups (figure 6B,C). Moreover, these mice survived significantly longer relative to mice treated with unarmed iNK-CD64/16A IL-15RF cells or cetuximab alone (figure 6D). Taken together, the findings above demonstrate that antibody-armed iNK-CD64/16A IL-15RF cells exhibit antitumor function in vivo following a freeze/thaw cycle and in the presence of high levels of competing human IgG. Administering additional mAb therapies may extend and redirect their antitumor activity, increasing durability of response in clinical settings.

    Figure 6
    Figure 6

    Cryopreserved antibody-armed iNK-CD64/16A IL-15RF cells along with added therapeutic monoclonal antibody control tumor in the presence of competing IgG. (A) NSG mice were implanted i.p. with SKOV-3-Luc cells (3×105), administered GAMMAGARD (20 mg), iNK-CD64/16A IL-15RF cells (1×107), and cetuximab (50 µg) i.p., and tumor burden evaluated by BLI, as indicated in the schematic. (B) Tumor implanted mice were randomized into four groups: tumor alone (n=5), unarmed iNK-CD64/16A IL-15RF cells (iNK-CD64/16A) (n=5), cetuximab (n=5), or trastuzumab-armed iNK-CD64/16A IL-15RF cells plus cetuximab (n=5) (iNK-CD64/16A Tras+cetuximab) (n=5). All mice received i.p. injections of GAMMAGARD. The y-axis=percent change in radiance, as described in figure 1D. Data are represented as mean±SD; *, p≤0.05; **, p≤0.01 by Mann-Whitney test. (C) Bioluminescence images through the first 4 weeks of the experiments. (D) Kaplan-Meier curves for the in vivo SKOV-3 experiment. Statistical significance was determined using a log-rank (Mantel-Cox) test. **p≤0.01. BLI, bioluminescence imaging; HSD, honest significant difference; IL-15RF, interleukin-15Rα fusion; iNK, induced pluripotent stem cell-derived NK cell; i.p., intraperitoneal; IVIS, in vivo imaging system; NK, natural killer.

    Discussion

    Advantages of NK cell therapy are their favorable safety profile and assorted means of tumor cell detection, including missing-self, tumor ligands, death receptors, and antibody recognition by CD16A.1 4 The latter can be used to direct NK cells to specific tumor antigens to mediate ADCC. Therapeutic antibodies are the most rapidly growing immunotherapy for cancer and offer an ever-increasing arsenal of tumor targeting agents. Receptor/IgG1 Fc constructs, such as NKG2D-Fc,47 are also being developed to target ligands upregulated by tumor cells and other cells in the tumor microenvironment. Antibody therapies offer lower cost and readily switchable targeting elements for NK cells compared with the complex process of manufacturing NK cells with different chimeric antigen receptors (CARs) or other fixed antigen specific receptors.

    We examined the unique recombinant fusion FcγR CD64/16A, consisting of the extracellular region of CD64 and the transmembrane and cytoplasmic regions of CD16A, expressed in iNK cells to enhance their inherent ADCC capacity. A property unique to CD64 is its high affinity binding to monomeric IgG with 1:1 stoichiometry and without steric hindrance.48 CD64/16A on NK cells can therefore act as a docking platform for antitumor therapeutic mAbs and receptor/Fc chimeric molecules.17 Our study focused on the ADCC capacity of antibody-armed iNK-CD64/16A cells. Potential advantages of this approach are their immediate targeting of tumor antigens on administration, akin to CAR NK cells, but with adaptable tumor antigen targeting by using different antibody therapies. Moreover, antibody therapies used to induce FcR effector functions are administered at high concentrations, and this can induce toxicity and adverse events.49 Arming iNK-CD64/16A cells would allow for administering far less antibody and may decrease cost and toxicity. We show here that therapeutic mAbs can be coupled to freshly expanded as well as cryopreserved iNK-CD64/16A cells and that they mediated robust ADCC. In addition, antibody-armed iNK-CD64/16A cells can be cryopreserved, thawed, and mediate multiple rounds of ADCC. Cryopreserved, antibody-armed iNK-CD64/16A cells also mediated ADCC in vivo. To increase the stringency and clinical relevancy of this approach, we established a xenograft mouse model with high levels of human IgG, as occurs in blood and ovarian cancer ascites fluid,43 to compete with the mAb therapies.

    Of interest is that antibody-armed iNK cells could be repurposed or redirected by the addition of free antibody. It is well established that cell surface CD64 on circulating myeloid cells is occupied by plasma IgG, yet these cells still use the FcγR to bind antibody-opsonized cells to mediate their effector functions.39 50 A mechanism that accounts for this is “inside-out signaling” in which cell activation leads to an increase in CD64 binding affinity and preferential binding to antibody-coated cells.39 Indeed, CD64-expressing myeloid cells have been reported to play a significant role in the efficacy of antibody-therapies in syngeneic mouse tumor models.51–53 The repurposing of infused antibody-armed iNK-CD64/16A cells with an additional mAb therapy may involve a similar process, which will be interesting to investigate further. The infusion of antibody-armed iNK-CD64/16A cells followed by mAb therapies could potentially be used to extend the targeting of these cells to the same tumor antigen or redirect them to a new one.

    To take advantage of engineerable iPSCs to generate multiplexed edited NK cells, an additional modification of iNK-CD64/16A cells performed was their expression of IL-15RF. Potential benefits of this include extending iNK-CD64/16A cell persistence in vivo, enhancing their functional state, and eliminating the need for cytokine dosing, which in turn would reduce treatment costs, toxicity, and detrimental immunoregulatory responses. Cytokine stimulation of myeloid cells can increase CD64 affinity for IgG,39 and perhaps IL-15RF signaling may also do the same for CD64/16A in iNK cells. CD64/16A and IL-15RF expression in iNK cells provides innovative strategies to enhance the ADCC potency of this ACT. In conclusion, a critical barrier to the development of effective cellular therapies for solid tumors, such as ovarian cancer, is heterogenous antigen expression. Antibody-armed iNK-CD64/16A IL-15RF cells available off-the-shelf plus/minus subsequent infusion of additional tumor-targeting mAbs provide a highly flexible platform for multiantigen targeting to overcome tumor heterogeneity and antigen escape.

    Data availability statement

    Data are available upon reasonable request. All data relevant to the study are included in the article or uploaded as supplementary information.

    Ethics statements

    Patient consent for publication

    Ethics approval

    This study involves human participants and was approved by University of Minnesota, Internal Review Board, human subjects code number 9708M00134. Participants gave informed consent to participate in the study before taking part.

    References

    1. ↵
      1. Wolf NK,
      2. Kissiov DU,
      3. Raulet DH
      . Roles of natural killer cells in immunity to cancer, and applications to Immunotherapy. Nat Rev Immunol 2023;23:90–105. doi:10.1038/s41577-022-00732-1
      OpenUrl
    2. ↵
      1. Gauthier M,
      2. Laroye C,
      3. Bensoussan D, et al
      . Natural killer cells and Monoclonal antibodies: two partners for successful antibody dependent cytotoxicity against tumor cells. Crit Rev Oncol Hematol 2021;160:103261. doi:10.1016/j.critrevonc.2021.103261
      OpenUrlCrossRef
    3. ↵
      1. Ramírez-Labrada A,
      2. Pesini C,
      3. Santiago L, et al
      . All about (NK cell-mediated) death in two acts and an unexpected encore: initiation, execution and activation of adaptive immunity. Front Immunol 2022;13:896228. doi:10.3389/fimmu.2022.896228
      OpenUrl
    4. ↵
      1. Maskalenko NA,
      2. Zhigarev D,
      3. Campbell KS
      . Harnessing natural killer cells for cancer Immunotherapy: dispatching the first responders. Nat Rev Drug Discov 2022;21:559–77. doi:10.1038/s41573-022-00413-7
      OpenUrl
    5. ↵
      1. Wu J,
      2. Mishra HK,
      3. Walcheck B
      . Role of Adam17 as a regulatory Checkpoint of Cd16A in NK cells and as a potential target for cancer Immunotherapy. J Leukoc Biol 2019;105:1297–303. doi:10.1002/JLB.2MR1218-501R
      OpenUrlCrossRef
    6. ↵
      1. Lai P,
      2. Rabinowich H,
      3. Crowley-Nowick PA, et al
      . Alterations in expression and function of signal-Transducing proteins in tumor-associated T and natural killer cells in patients with ovarian carcinoma. Clin Cancer Res 1996;2:161–73.
      OpenUrlAbstract/FREE Full Text
    7. ↵
      1. Jewett A,
      2. Tseng HC
      . Tumor induced inactivation of natural killer cell cytotoxic function; implication in growth, expansion and differentiation of cancer stem cells. J Cancer 2011;2:443–57. doi:10.7150/jca.2.443
      OpenUrlPubMed
    8. ↵
      1. Felices M,
      2. Chu S,
      3. Kodal B, et al
      . IL-15 super-agonist (ALT-803) enhances natural killer (NK) cell function against ovarian cancer. Gynecol Oncol 2017;145:453–61. doi:10.1016/j.ygyno.2017.02.028
      OpenUrlCrossRefPubMed
    9. ↵
      1. Rzymski T,
      2. Petry A,
      3. Kračun D, et al
      . The unfolded protein response controls induction and activation of Adam17/TACE by severe hypoxia and ER stress. Oncogene 2012;31:3621–34. doi:10.1038/onc.2011.522
      OpenUrlCrossRefPubMedWeb of Science
    10. ↵
      1. Bruhns P,
      2. Iannascoli B,
      3. England P, et al
      . Specificity and affinity of human Fcgamma receptors and their polymorphic variants for human IgG Subclasses. Blood 2009;113:3716–25. doi:10.1182/blood-2008-09-179754
      OpenUrlAbstract/FREE Full Text
    11. ↵
      1. Wu J,
      2. Edberg JC,
      3. Redecha PB, et al
      . A novel polymorphism of Fcgammariiia (Cd16) alters receptor function and predisposes to autoimmune disease. J Clin Invest 1997;100:1059–70. doi:10.1172/JCI119616
      OpenUrlCrossRefPubMedWeb of Science
    12. ↵
      1. Cartron G,
      2. Dacheux L,
      3. Salles G, et al
      . Therapeutic activity of Humanized anti-Cd20 Monoclonal antibody and polymorphism in IgG FC receptor Fcgammariiia gene. Blood 2002;99:754–8. doi:10.1182/blood.v99.3.754
      OpenUrlAbstract/FREE Full Text
    13. ↵
      1. Liu G,
      2. Tu D,
      3. Lewis M, et al
      . Fc-gamma receptor Polymorphisms, Cetuximab therapy, and survival in the NCIC CTG CO.17 trial of colorectal cancer. Clin Cancer Res 2016;22:2435–44. doi:10.1158/1078-0432.CCR-15-0414
      OpenUrlAbstract/FREE Full Text
    14. ↵
      1. Musolino A,
      2. Naldi N,
      3. Bortesi B, et al
      . Immunoglobulin G fragment C receptor Polymorphisms and clinical efficacy of Trastuzumab-based therapy in patients with HER-2/neu-positive metastatic breast cancer. J Clin Oncol 2008;26:1789–96. doi:10.1200/JCO.2007.14.8957
      OpenUrlCrossRefPubMed
    15. ↵
      1. Vitale M,
      2. Cantoni C,
      3. Pietra G, et al
      . Effect of tumor cells and tumor Microenvironment on NK-cell function. Eur J Immunol 2014;44:1582–92. doi:10.1002/eji.201344272
      OpenUrlCrossRefPubMed
    16. ↵
      1. Zahavi D,
      2. AlDeghaither D,
      3. O’Connell A, et al
      . Enhancing antibody-dependent cell-mediated cytotoxicity: a strategy for improving antibody-based Immunotherapy. Antib Ther 2018;1:7–12. doi:10.1093/abt/tby002
      OpenUrl
    17. ↵
      1. Snyder KM,
      2. Hullsiek R,
      3. Mishra HK, et al
      . Expression of a recombinant high affinity IgG FC receptor by engineered NK cells as a docking platform for therapeutic mAbs to target cancer cells. Front Immunol 2018;9:2873. doi:10.3389/fimmu.2018.02873
    18. ↵
      1. Nimmerjahn F,
      2. Ravetch JV
      . Fcgamma receptors as regulators of immune responses. Nat Rev Immunol 2008;8:34–47. doi:10.1038/nri2206
      OpenUrlCrossRefPubMedWeb of Science
    19. ↵
      1. Lanier LL,
      2. Yu G,
      3. Phillips JH
      . Co-Association of Cd3 Zeta with a receptor (Cd16) for IgG FC on human natural killer cells. Nature 1989;342:803–5. doi:10.1038/342803a0
      OpenUrlCrossRefPubMed
    20. ↵
      1. Letourneur O,
      2. Kennedy IC,
      3. Brini AT, et al
      . Characterization of the family of dimers associated with FC receptors (FC epsilon RI and FC gamma RIII). J Immunol 1991;147:2652–6.
      OpenUrlAbstract/FREE Full Text
    21. ↵
      1. Blázquez-Moreno A,
      2. Park S,
      3. Im W, et al
      . Transmembrane features governing FC receptor Cd16A assembly with Cd16A signaling adaptor molecules. Proc Natl Acad Sci U S A 2017;114:E5645–54. doi:10.1073/pnas.1706483114
      OpenUrlAbstract/FREE Full Text
    22. ↵
      1. Walcheck B,
      2. Wu J
      . iNK-Cd64/16A cells: a promising approach for ADCC Expert Opin Biol Ther 2019;19:1229–32. doi:10.1080/14712598.2019.1667974
      OpenUrl
    23. ↵
      1. Binyamin L,
      2. Alpaugh RK,
      3. Hughes TL, et al
      . Blocking NK cell inhibitory self-recognition promotes antibody-dependent cellular cytotoxicity in a model of anti-lymphoma therapy. J Immunol 2008;180:6392–401. doi:10.4049/jimmunol.180.9.6392
      OpenUrlAbstract/FREE Full Text
    24. ↵
      1. Valamehr B,
      2. Robinson M,
      3. Abujarour R, et al
      . Platform for induction and maintenance of transgene-free hiPSCs resembling ground state Pluripotent stem cells. Stem Cell Reports 2014;2:366–81. doi:10.1016/j.stemcr.2014.01.014
      OpenUrl
    25. ↵
      1. Goldenson BH,
      2. Hor P,
      3. Kaufman DS
      . iPSC-derived natural killer cell therapies - expansion and targeting. Front Immunol 2022;13:841107. doi:10.3389/fimmu.2022.841107
    26. ↵
      1. Hermanson DL,
      2. Bendzick L,
      3. Pribyl L, et al
      . Induced Pluripotent stem cell-derived natural killer cells for treatment of ovarian cancer. Stem Cells 2016;34:93–101. doi:10.1002/stem.2230
      OpenUrlCrossRefPubMed
    27. ↵
      1. Zeng J,
      2. Tang SY,
      3. Toh LL, et al
      . “Generation of "off-the-shelf" natural killer cells from peripheral blood cell-derived induced Pluripotent stem cells”. Stem Cell Reports 2017;9:1796–812. doi:10.1016/j.stemcr.2017.10.020
      OpenUrl
    28. ↵
      1. Saetersmoen ML,
      2. Hammer Q,
      3. Valamehr B, et al
      . Off-the-shelf cell therapy with induced Pluripotent stem cell-derived natural killer cells. Semin Immunopathol 2019;41:59–68. doi:10.1007/s00281-018-0721-x
      OpenUrlCrossRef
    29. ↵
      1. Cichocki F,
      2. van der Stegen SJC,
      3. Miller JS
      . Engineered and banked iPSCs for advanced NK and T cell Immunotherapies. Blood 2023;141:846–55. doi:10.1182/blood.2022016205
      OpenUrl
    30. ↵
      1. Zhu H,
      2. Blum RH,
      3. Bjordahl R, et al
      . Pluripotent stem cell-derived NK cells with high-affinity Noncleavable Cd16A mediate improved antitumor activity. Blood 2020;135:399–410. doi:10.1182/blood.2019000621
      OpenUrlCrossRefPubMed
    31. ↵
      1. Cichocki F,
      2. Goodridge JP,
      3. Bjordahl R, et al
      . Dual antigen-targeted off-the-shelf NK cells show durable response and prevent antigen escape in lymphoma and leukemia. Blood 2022;140:2451–62. doi:10.1182/blood.2021015184
      OpenUrl
    32. ↵
      1. Cichocki F,
      2. Bjordahl R,
      3. Gaidarova S, et al
      . iPSC-derived NK cells maintain high cytotoxicity and enhance in vivo tumor control in concert with T cells and anti-PD-1 therapy. Sci Transl Med 2020;12:eaaz5618. doi:10.1126/scitranslmed.aaz5618
    33. ↵
      1. Woan KV,
      2. Kim H,
      3. Bjordahl R, et al
      . Harnessing features of adaptive NK cells to generate iPSC-derived NK cells for enhanced Immunotherapy. Cell Stem Cell 2021;28:2062–75. doi:10.1016/j.stem.2021.08.013
      OpenUrlCrossRefPubMed
    34. ↵
      1. Cichocki F,
      2. Bjordahl R,
      3. Goodridge JP, et al
      . Quadruple gene-engineered natural killer cells enable multi-antigen targeting for durable antitumor activity against multiple myeloma. Nat Commun 2022;13:7341. doi:10.1038/s41467-022-35127-2
    35. ↵
      1. Kiyoshi M,
      2. Caaveiro JMM,
      3. Kawai T, et al
      . Structural basis for binding of human Igg1 to its high-affinity human receptor Fcgammari. Nat Commun 2015;6:6866. doi:10.1038/ncomms7866
    36. ↵
      1. Halkia E,
      2. Spiliotis J,
      3. Sugarbaker P
      . Diagnosis and management of peritoneal metastases from ovarian cancer. Gastroenterol Res Pract 2012;2012:541842. doi:10.1155/2012/541842
    37. ↵
      1. Geller MA,
      2. Knorr DA,
      3. Hermanson DA, et al
      . Intraperitoneal delivery of human natural killer cells for treatment of ovarian cancer in a mouse Xenograft model. Cytotherapy 2013;15:1297–306. doi:10.1016/j.jcyt.2013.05.022
      OpenUrlCrossRefPubMed
    38. ↵
      1. Uppendahl LD,
      2. Dahl CM,
      3. Miller JS, et al
      . Natural killer cell-based Immunotherapy in gynecologic malignancy: a review. Front Immunol 2017;8:1825. doi:10.3389/fimmu.2017.01825
      OpenUrl
    39. ↵
      1. Holtrop T,
      2. Budding K,
      3. Brandsma AM, et al
      . Targeting the high affinity receptor, Fcgammari, in autoimmune disease, neuropathy, and cancer. Immunother Adv 2022;2:ltac011. doi:10.1093/immadv/ltac011
    40. ↵
      1. Romee R,
      2. Foley B,
      3. Lenvik T, et al
      . NK cell Cd16 surface expression and function is regulated by a Disintegrin and Metalloprotease-17 (Adam17). Blood 2013;121:3599–608. doi:10.1182/blood-2012-04-425397
      OpenUrlAbstract/FREE Full Text
    41. ↵
      1. Yang Y,
      2. Lundqvist A
      . Immunomodulatory effects of IL-2 and IL-15; implications for cancer Immunotherapy. Cancers (Basel) 2020;12:3586. doi:10.3390/cancers12123586
    42. ↵
      1. Agarwal S,
      2. Cunningham-Rundles C
      . Assessment and clinical interpretation of reduced IgG values. Ann Allergy Asthma Immunol 2007;99:281–3. doi:10.1016/S1081-1206(10)60665-5
      OpenUrlCrossRefPubMedWeb of Science
    43. ↵
      1. Bjørge L,
      2. Hakulinen J,
      3. Vintermyr OK, et al
      . Ascitic complement system in ovarian cancer. Br J Cancer 2005;92:895–905. doi:10.1038/sj.bjc.6602334
      OpenUrlCrossRefPubMedWeb of Science
    44. ↵
      1. Mian SA,
      2. Anjos-Afonso F,
      3. Bonnet D
      . Advances in human immune system Mouse models for studying human Hematopoiesis and cancer Immunotherapy. Front Immunol 2020;11:619236. doi:10.3389/fimmu.2020.619236
    45. ↵
      1. Yu H,
      2. Borsotti C,
      3. Schickel J-N, et al
      . A novel Humanized mouse model with significant improvement of class-switched, antigen-specific antibody production. Blood 2017;129:959–69. doi:10.1182/blood-2016-04-709584
      OpenUrlAbstract/FREE Full Text
    46. ↵
      1. Li F,
      2. Ulrich ML,
      3. Shih VF-S, et al
      . Mouse strains influence clearance and efficacy of antibody and antibody-drug conjugate via FC-Fcgammar interaction. Mol Cancer Ther 2019;18:780–7. doi:10.1158/1535-7163.MCT-18-0977
      OpenUrlAbstract/FREE Full Text
    47. ↵
      1. Raab S,
      2. Steinbacher J,
      3. Schmiedel BJ, et al
      . Fc-Optimized Nkg2D-FC Constructs induce NK cell antibody-dependent cellular cytotoxicity against breast cancer cells independently of Her2/neu expression status. J Immunol 2014;193:4261–72. doi:10.4049/jimmunol.1400872
      OpenUrlAbstract/FREE Full Text
    48. ↵
      1. Capkin E,
      2. Kurt H,
      3. Gurel B, et al
      . Characterization of Fcgammaria (Cd64) as a ligand molecule for site-specific Igg1 capture: A side-by-side comparison with protein A. Langmuir 2022;38:14623–34. doi:10.1021/acs.langmuir.2c02022
      OpenUrl
    49. ↵
      1. Baldo BA
      . Adverse events to Monoclonal antibodies used for cancer therapy: focus on hypersensitivity responses. Oncoimmunology 2013;2:e26333. doi:10.4161/onci.26333
    50. ↵
      1. Brandsma AM,
      2. Schwartz SL,
      3. Wester MJ, et al
      . Mechanisms of inside-out signaling of the high-affinity IgG receptor FcγRI. Sci Signal 2018;11:eaaq0891. doi:10.1126/scisignal.aaq0891
    51. ↵
      1. Bevaart L,
      2. Jansen MJH,
      3. van Vugt MJ, et al
      . The high-affinity IgG receptor, Fcgammari, plays a central role in antibody therapy of experimental Melanoma. Cancer Res 2006;66:1261–4. doi:10.1158/0008-5472.CAN-05-2856
      OpenUrlAbstract/FREE Full Text
    52. ↵
      1. Albanesi M,
      2. Mancardi DA,
      3. Macdonald LE, et al
      . Cutting edge: Fcgammariii (Cd16) and Fcgammari (Cd64) are responsible for anti-glycoprotein 75 Monoclonal antibody Ta99 therapy for experimental metastatic B16 Melanoma. J Immunol 2012;189:5513–7. doi:10.4049/jimmunol.1201511
      OpenUrlAbstract/FREE Full Text
    53. ↵
      1. Mancardi DA,
      2. Albanesi M,
      3. Jönsson F, et al
      . The high-affinity human IgG receptor Fcgammari (Cd64) promotes IgG-mediated inflammation, Anaphylaxis, and antitumor Immunotherapy. Blood 2013;121:1563–73. doi:10.1182/blood-2012-07-442541
      OpenUrlAbstract/FREE Full Text

    Footnotes

    • Correction notice This article has been corrected since it was first published online. Figure 3 has had parts D, E and F added to the figure.

    • Contributors KMS, KJD, AWM conducted experiments and analyzed data. ZBD and MK provided technical assistance. RB, BH, and SS provided critical reagents. MH, BV, JM, and JW provided scientific input. KMS, KJD, BV, MH, JW, and BW designed the research and wrote the manuscript with edits from all authors. BW acts as guarantor of the work presented here.

    • Funding This work was supported by NIH R01CA203348 (to BW and JW) and a Howard Hughes Medical Institute and Burroughs Wellcome Fund Medical Research Fellowship (to KMS).

    • Competing interests JW and BW are inventors on the patent application WO2019084388A1 (Recombinant immune cells, methods of making, and methods of use). Human CD64/16A described in the patent application has been exclusively licensed to Fate Therapeutics. JSM is a paid consultant for Fate Therapeutics and JW, BW and JSM receive research funds from Fate Therapeutics. Fate Therapeutics owns patent No. 10626372 (Methods and compositions for inducing hematopoietic cell differentiation) covering the iPSC derived NK cells. MH, RB, BH, SS, and BV are employees of Fate Therapeutics. All other authors declare no conflicts.

    • Provenance and peer review Not commissioned; externally peer reviewed.