Table 2

Primers for real-time PCR

GenesForward (5′−3′)Reverse (5′−3′)
hβ-ACTINCTCTTCCAGCCTTCCTTCCTCAGGGCAGTGATCTCCTTCT
h-FPR2TTCACGGCCACATTACCATTCAATCCAAGGTCCGACGATCAC
hANXA1GCGGTGAGCCCCTATCCTATGATGGTTGCTTCATCCACAC
hGZMATCTCTCTCAGTTGTCGTTTCTCTGCAGTCAACACCCAGTCTTTTG
hGZMBCCCTGGGAAAACACTCACACAGCACAACTCAATGGTACTGTCG
hCCR8GTGTGACAACAGTGACCGACTCTTCTTGCAGACCACAAGGAC
hPDCD1CCAGGATGGTTCTTAGACTCCCTTTAGCACGAAGCTCTCCGAT
hIL2RAGTGGGGACTGCTCACGTTCCCCGCTTTTTATTCTGCGGAA
hTGFB1GGCCAGATCCTGTCCAAGCGTGGGTTTCCACCATTAGCAC
hIL-10GACTTTAAGGGTTACCTGGGTTGTCACATGCGCCTTGATGTCTG
hCTLA4GCCCTGCACTCTCCTGTTTTTGGTTGCCGCACAGACTTCA
hNT5EGCCTGGGAGCTTACGATTTTGTAGTGCCCTGGTACTGGTCG
hPRF1GGCTGGACGTGACTCCTAAGCTGGGTGGAGGCGTTGAAG
hENTPD1TTGGTTTGAGGGTATCTTCCTGTCCTTGAACGGTCTCAGCACC
  • h indicates human.