Introduction

Hepatocellular carcinoma (HCC) is one of the major cancer burdens in China [1]. Hepatitis B virus (HBV) infection has been well established as a risk factor for liver carcinogenesis [2]. HBV persistent infection or HBV natural clearance is influenced by complex factors of viral, host age, environmental and genetic makeup, while hereditary factors may also play critical roles in the pathogenesis of HCC, together with other environmental factors, such as cigarette smoking, alcohol drinking and aflatoxins ingestion [3], [4].

MicroRNAs (miRNAs) are small non-coding RNAs that may regulate genes expression, either by inhibiting target mRNA translation or inducing its degradation [5]. Alterations of miRNA, including expression disorders and mutations, are involved in the initiation and progression of human cancers [6]. Accumulating data revealed that a subset of miRNAs deregulated in HCC [7], [8], [9], [10], [11]. Among them, miR-106b-25 cluster, including miR-106b, miR-93 and miR-25, is of particular interest, for its integral roles in diverse processes including immune response and tumorigenesis [11], [12], [13]. The cluster is hosted in intron 13 of MCM7, the abbreviation of minichromosome maintenance complex component 7, and Petrocca et al indicated that its transcription might be driven by the host gene [14]. We searched single nucleotide polymorphisms (SNPs) in the promoter region of MCM7 with the criteria of minor allele frequency (MAF)>0.05 in Han Chinese and found two SNPs(rs4319008 and rs999885) in high linkage disequilibrium (LD) (r-square = 1). We chose rs999885 and performed a case-control study including 1300 HBV positive HCC cases, 1344 HBV persistent carriers and 1344 HBV natural clearance subjects to test the association between this SNP and risk of HBV persistent infection and HCC.

Methods

Quantitative Reverse Transcriptase–Polymerase Chain Reaction (RT-PCR)

Quantitative RT-PCR was performed to determine the expression level of miR-106b-25 cluster with Power SYBR Green PCR Master Mix (Applied Biosystems Inc.) and the primers were shown in Fig. 1A. Normalization was performed with β-actin (sense, 5′- AGAAAATCTGGCACCACACC -3′, antisense, 5′- GGGGTGTTGAAGGTCTCAAA -3′). All PCR reactions, including no-template controls and real-time minus controls, were performed in triplicate. A relative expression was calculated using the equation 2^−ΔCt, in which ΔCt = Ct_gene−Ct_β-actin, and also the equation 2^−ΔΔCt, in which ΔΔCt = (Ct_normal−Ct_{β-actin-normal})−(Ct_tumor−Ct_{β-actin-tumor}).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 1. Genotype–expression correlations for rs999885 and miR-106b-25 cluster expression levels.

(A) The positions and sequences of the primers used for RT-PCR to quantify the level of miR-106b-25 cluster are indicated. (B, C) Quantitative RT-PCR was used to measure expression levels of miR-106b-25 cluster in 25 pairs of HCC and adjacent non-tumor liver tissues. Normalization was performed by the β-actin. Genotype–expression correlations for genotypes and expression levels of miR-106b-25 cluster in normal and tumor tissues, respectively, which were calculated by using the equation 2^−ΔCt, and ΔCt = Ct_normal(Ct_tumor)−Ct_{β-actin-normal}(Ct_{β-actin-tumor}). (D) Genotype–expression correlation for rs999885 and the expression level of miR-106b-25 cluster, which was calculated by using the equation 2^−ΔΔCt, and ΔΔCt = (Ct_normal−Ct_{β-actin-normal})−(Ct_tumor−Ct_{β-actin-tumor}).

https://doi.org/10.1371/journal.pone.0032230.g001

Results

The demographic characteristics of the 1300 HBV positive HCC cases, 1344 HBV persistent carriers and 1344 persons with HBV natural clearance have been summarized previously [15]. Briefly, no significant differences were detected in the age and gender distributions between the three groups (P = 0.839 and 0.716, respectively). Smoking rates were also similar between the three groups. However, the drinking rates were higher among cases than that in controls (P<0.001 for both HCC cases compare to HBV persistent carriers and clearance controls).

The genotyping call rate for rs999885 was 98.65%. The genotype distributions of rs999885 in HBV positive HCC cases, HBV persistent carriers and HBV natural clearance subjects are shown in Table 1. In the logistic regression analyses between HBV persistent carriers and HBV natural clearance subjects, it was shown that the variant genotypes (AG/GG) of rs999885 were associated with a significantly decreased risk for chronic HBV infection (adjusted OR = 0.79, 95% CIs = 0.67–0.93, P = 0.004) in the dominant genetic model. However, compared with the HBV persistent carriers carrying wild-type AA of rs999885, those with the AG genotype had an increased risk for HCC with adjusted OR of 1.28 (95% CIs = 1.08–1.52), and the AG/GG genotypes had an increased risk by 25% (adjusted OR = 1.25, 95% CIs = 1.06–1.47, P = 0.008) (Table 1).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 1. Genotype frequencies of rs999885 and susceptibility of HCC and HBV persistent infection.

https://doi.org/10.1371/journal.pone.0032230.t001

The association between rs999885 and the susceptibility to HCC and HBV persistent infection was also evaluated by stratifying on age, gender, drinking and smoking status (Table S1). However, no significant heterogeneity was detected between the subgroups, implying independent genetic effect of rs999885.

To characterize the functional relevance of the SNP rs999885, we conducted a correlation analysis between the rs999885 genotypes and the expression levels of miR-106b-25 cluster. We found that, in the 25 pairs of tissue specimens, 8 had the rs999885 AA genotype, 16 with the AG genotype, and 1 with the GG genotype. As shown in Fig. 1B, the expression levels of miR-106b-25 were significantly higher in AG/GG carriers than those in AA carriers in normal liver tissues (0.024±0.033 for AG/GG vs. 0.006±0.017 for AA, P = 0.016). Furthermore, as shown in Fig. 1D, the relative expression levels between HCC and normal liver tissues of miR-106b-25 were also higher in AG/GG carriers than those in AA carriers (20.633±30.152 for AG/GG vs. 3.394±12.090 for AA, P = 0.043).

Discussion

In this study, we investigated the association between rs999885 and the susceptibility to HBV persistent infection and HCC in a Chinese population. We found that the A to G base change of rs999885 demonstrated protective effect on chronic HBV infection, but increased the risk of HCC in HBV persistent carriers.

To date, accumulating data has showed that miR-106b-25 cluster plays oncogenic roles in cancers, through influencing tumor growth, cell survival, and angiogenesis [16], [17], [18]. This cluster has been reported to be up-regulated in several cancers, including esophageal adenocarcinoma [18], gastric cancer [19], prostate cancer [20], head and neck squamous cell carcinoma [21], and HCC [11]. Specially, by sequencing analysis, it was shown that the expression levels of miR-106b, miR-93 and miR-25 were higher in liver cancer cell lines than those in normal liver cells [22]. In this study, we found that the expression levels of miR-106b-25 were significantly higher in AG/GG carriers, which was consistent with the risk effect of the variant genotypes. However, reverse findings were reported in immune disorders. De Santis et al found that miR-106b-25 down-regulated in multiple sclerosis patients compared to healthy donors in specific T regulatory cells [23], which might support the protective role of the variant genotypes of rs999885 on susceptibility to chronic HBV infection. In addition, several independent studies also revealed that miR-106b-25 cluster promoted cell cycle progression by suppressing the Cip/Kip family members of Cdk inhibitors, in which miR-25 targeted p57, while miR-106b and miR-93 controlled p21 [17], [24], [25]. Moreover, the miR-106b-25 cluster may resist the TGF-β tumor suppression pathway [26], and miR-93 alone may promote tumor growth and angiogenesis by suppressing integrin-β8 expression [16].

The miR-106b-25 polycistron is activated by genomic amplification and over-expression of MCM7 [27], and the miR-106b-25 cluster may cooperate with its host gene MCM7 in cellular transformation [28]. The SNP rs999885 (A>G) is located at 1749-bp upstream from transcriptional start position of MCM7. According to the web-based SNP analysis tool (TFSEARCH 1.3), the A allele of rs999885 may have high affinity with a transcription factor, sex-determining region Y protein (SRY), which involved in gene regulation including promoter activation or repression depending on its interacted protein [29], [30]. In the current study, we provided evidence that the rs999885 variant could influence miR-106b-25 expression.

In summary, this study, with a relative large population, showed that a genetic variant in the promoter region of miR-106b-25 cluster might provide a protective effect against chronic HBV infection but an increased risk for HCC in HBV persistent carriers by affecting the expression of miR-106b-25 cluster. Further studies incorporating diverse populations and functional assays are warranted to validate and extend our findings.

Supporting Information